addgene pooled library (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
addgene pooled library
Addgene Pooled Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 279 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispr+knockout+pooled+library+brunello+addgene/Human+CRISPR+Knockout+Pooled+Library+(Brunello)+(Pooled+Library+%2373179%2C+%2373179-LV%2C+%2373178%2C+%2373178-LV)/pm41875887-830-52-52
Average 96 stars, based on 279 article reviews
Addgene Pooled Library, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 279 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/human+crispr+knockout+pooled+library+brunello+addgene/Human+CRISPR+Knockout+Pooled+Library+(Brunello)+(Pooled+Library+%2373179%2C+%2373179-LV%2C+%2373178%2C+%2373178-LV)/pm41875887-830-52-52
Average 96 stars, based on 279 article reviews
addgene pooled library - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Plasmid Preparation:Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-BFP-2A-BFP , This study , N/A. .. Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-BFP-2A-Puro-sgCMTM6#2 (TCACAATGT ACTTTATGTGG) , This study , Sequencing:Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-BFP-2A-BFP , This study , N/A. .. Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-BFP-2A-Puro-sgCMTM6#2 (TCACAATGT ACTTTATGTGG) , This study , CRISPR:Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-BFP-2A-BFP , This study , N/A. .. Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-BFP-2A-Puro-sgCMTM6#2 (TCACAATGT ACTTTATGTGG) , This study , Knock-Out:Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-BFP-2A-BFP , This study , N/A. .. Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgNT (non-targeting)(GTATTACTG ATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCD58(GCAGCAGGCAGACCACGCTG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgPD-L1(CACCACCAATTCCAAGAGAG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiCRISPRv2-sgCMTM6#1 (CCGGGTCCTCCTCCGTAGTG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiCRISPRv2-sgCMTM6#2 (TCACAATGTACTTTATGTGG) , This study , Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1 Article Snippet: Plasmid: pLentiGuide-GFP-2A-Puro-sgNT (non-targeting) (GTATTACTGATATTGGTGGG) , This study , sgRNA sequence is extracted from Human CRISPR Knockout Pooled Library (Brunello) Addgene: 73178. .. Plasmid: pLentiGuide-BFP-2A-Puro-sgCMTM6#2 (TCACAATGT ACTTTATGTGG) , This study , other:Article Title: CMTM6 shapes antitumor T cell response through modulating protein expression of CD58 and PD-L1. Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant DNA Plasmid: |